تاریخ :۹ بهمن ۱۴۰۱
  • آشنایی با تکنیک ARMS PCR

    تکنیک ARMS PCR: تکنیک ARMS-PCR تکثیری قدرتمند برای مشخص کردن جهش های نقطه ای است. در این تکنیک از پرایمرهای جهش یافته و پرایمرهای طبیعی در دو میکروتیوپ جداگانه استفاده می شود. اگر عمل پلیمریزاسیون در لوله حاوی پرایمر طبیعی انجام شود، نشان دهنده نبود جهش نقطه ای در باز مورد نظر است. اگر عمل پلیمریزاسیون در لوله حاوی پرایمر جهش یافته انجام شود، نشان دهنده حضور جهش نقطه ای در باز مورد نظر است.

    تکنیک ARMS PCR یکی از انواع PCR است که در آن DNA توسط آغازگرهای اختصاصی آلل تکثیر می شود. در صورت mismatch در انتهای ‘۳ آغازگر، می توان اتصال و از این رو تکثیر را به طرز چشمگیری کاهش داد. این به دلیل عدم وجود فعالیت تصحیح اگزونوکلئازی ‘۳ به ‘۵ آنزیم Taq پلیمراز است. به همین دلیل این نوع از DNA پلیمرازها نمی توانند در تکنیک ARMS استفاده شوند.

    این یک روش بسیار مفید برای شناسایی جهش های نقطه ای یا چند شکلی است. از آنجا که ARMS PCR بیشتر برای شناسایی یک جهش یا چند شکلی انجام می شود، مهم است که تشخیص داده شود که آیا تغییر در DNA هتروزیگوت است یا هموزیگوت. هتروزیگوت یا هموزیگوت با استفاده از آغازگرهای ARMS برای آلل های جهش یافته/ چند شکلی و طبیعی (نوع وحشی) متمایز می شود. این واکنش برای آلل های جهش یافته و آلل های طبیعی معمولاً در لوله های جداگانه ای انجام می شوند، اما ممکن است پس از نشاندار کردن دو آغازگر با رنگ های مختلف فلورسنت، در همان لوله انجام شود.

    ARMS-PCR

    نام های دیگر این روش عبارتند از:

    • MAMA-PCR مخفف Mismatch Amplification Mutation Assay
    • COP-PCR مخفف Competitative Oligonucleotide Primming

    طراحی آغازگر در تکنیک ARMS PCR

    ARMS PCR به یک جفت آغازگر شامل یک آغازگر معمولی و ARMS نیاز دارد. آغازگر معمولی مانند هر آغازگر PCR دیگر است. آغازگر ARMS دارای ویژگی های ویژه زیر است:

    ۱- طول آغازگر معمولاً ۳۰ جفت باز است.

    ۲- نوکلئوتید در انتهای ‘۳ آغازگر باید مکمل نوکلئوتید هدف باشد. یعنی G برای C یا C برای G و T برای A یا A برای T. عدم تطابق در این موقعیت می تواند به طور چشمگیری تکثیر را کاهش دهد. عدم تطابق A:G ، G:A و C:C بدترین تأثیر را دارند در حالیکه سایر عدم تطابق ها دارای درجات مختلفی از تأثیر هستند. به عنوان مثال در یک جهش با جایگزینی AT، آغازگر ARMS PCR برای آلل جهش یافته باید آخرین نوکلئوتید با نوکلئوتید T مکمل باشد. برای مثال باید دارای نوکلئوتید A باشد. آغازگر آلل طبیعی در همان موقعیت باید مکمل نوکلئوتید A باشد یعنی باید نوکلئوتید T داشته باشد.

    ۳- عدم تطابق اضافی در یکی از پنج نوکلئوتید آخر از آغازگر ARMS، ویژگی آن را بیشتر می کند.

    ۴- وجود یک کنترل داخلی PCR در واکنش های ARMS. یک جفت آغازگر برای تکثیر ناحیه ای از ژن مورد مورد هدف که معمولاً عاری از جهش است، طراحی شده است. تکثیر ناحیه کنترل داخلی و عدم تکثیر توسط آغازگر ARMS منفی واقعی را نشان می دهد. در یک نتیجه منفی کاذب، نه آغازگر ARMS و نه کنترل داخلی هیچ تکثیری را نشان نمی دهد.

    آغازگر-ARMS-PCR

    ۵- حساسیت و ویژگی واکنش ARMS را می توان با شرایط واکنش دقیق کنترل کرد. طراحی مناسب آغازگر ، دمای اتصال بالاتر و تعداد محدود چرخه برای جلوگیری از نتایج کاذب مهم است. تعداد چرخه ها باید به اندازه ای باشد تا یک نتیجه مثبت واضح و حقیقی بدست آید. افزایش تعداد چرخه ها لزوماً می تواند باعث ایجاد نتایج اشتباه شود. همانطور که گفته شد، طول معمول آغازگر ARMS یاید ۳۰ جفت باز باشد. آغازگرهای با این طول از Tm و دمای اتصال بالایی برخوردار هستند و بنابراین دارای ویژگی بیشتری هستند.

    دلایل ایجاد نتیجه منفی کاذب

    1. مقادیر بسیار کم یا زیاد DNA الگو
    2. کیفیت پایین الگوی DNA
    3. عدم افزودن آغازگر
    4. آنزیم Taq پلیمراز یا سایر معرف ها
    5. وجود مهار کننده های PCR.

    شرایط مورد نیاز برای انجام تکنیک ARMS PCR

    1. لوکوس : ژن β-گلوبین
    2. شماره دسترسی ژن بانک:  NG_000007.3
    3. آلل: β-تالاسمی جهش یافته IVSI-5 (G-C)
    4. آغازگر رفت : ۵ACCTCACCCTGTGGAGCCAC
    5. آغازگر برگشت: ۵CTCCTTAAACCTGTCTTGTAACCTTGTTAG
    6. محصول تکثیر شده ۲۸۵ جفت باز
    7. آغازگر کنترل (رفت): ۵’-CAATGTATCATGCCTCTTTGCACC
    8. آغازگر کنترل (برگشت): ۵’-GAGTCAAGGCTGAGAGATGCAGGA
    9. محصول تکثیر شده: ۸۶۱ جفت باز
    10. حجم واکنش: ۲۵ میکرولیتر
    11. غلظت آغازگر: ۱ میکرولیتر (۵ پیکومول در هر میکروگرم)
    12. آنزیم تک پلیمراز : ۰/۵ واحد(۰٫۱ میکرولیتر)
    13. DNA الگو: ۲μl (300 ~ng)

    منبع: www.grcpk.com

    امتیاز شما به این مقاله چقدره؟

    میانگین امتیازات ۵ از ۵
    اشتراک‌گذاری

    دیدگاهتان را بنویسید

    نشانی ایمیل شما منتشر نخواهد شد.